Hacker News new | ask | show | jobs
by MrZander 400 days ago
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be changed.

That is one of the most incredible things I have ever read.

19 comments

One other fun part of gene editing in vivo is that we don't actually use GACU (T in DNA). It turns out that if you use Pseudouridine (Ψ) instead of uridine (U) then the body's immune system doesn't nearly alarm as much, as it doesn't really see that mRNA as quite so dangerous. But, the RNA -> Protein equipment will just make protiens it without any problems.

Which, yeah, that's a miraculous discovery. And it was well worth the 2023 Nobel in Medicine.

Like, the whole system for gene editing in vivo that we've developed is just crazy little discovery after crazy little discovery. It's all sooooo freakin' cool.

https://en.wikipedia.org/wiki/Pseudouridine

I remember from a few few years back that the lipid coating may have caused problems for the liver, when treating people for diseases that needed to target a lot of tissue, such as muscle disorders. Is that still the case?
You remember correctly. Moderna had a lot of problems with their drug trials due to the lipid nanoparticles they were using to transport mRNA. They were toxic to the liver upon repeat dosings. Unfortunately, it appears they never found a fix for the problem. Instead they gave up and found a "business solution" by pivoting from drugs to the (at the time) less profitable vaccines, on the grounds that vaccines are something you only need to take once so the toxicity issue could be dodged. Doh. That was in 2017.

https://www.statnews.com/2017/01/10/moderna-trouble-mrna/

By the time COVID vaccines came around a few years later there was no evidence they had fixed the problems with lipid nanoparticle delivery. I looked for such evidence extensively at the time, for example, announcements by Moderna of breakthroughs or trials of new drugs. Today the situation seems not much different. Note that Moderna's wikipedia article has a section on "rare disease therapeutics" but it's literally empty:

https://en.wikipedia.org/wiki/Moderna#Rare_disease_therapeut...

Because of their failure to progress beyond COVID vaccines Moderna's share price got slaughtered, falling from a peak of ~$450 to ~$25 today.

I don't know if other companies were able to find breakthroughs here, after COVID I stopped following the topic. Unfortunately, although mRNA tech has great potential, when normal safety standards were reimposed it appears that Moderna went back to being unable to make anything safe enough to launch.

What was the success of other means, such as sugars and proteins? Something like glycocalyx or polysaccharide capsules? Or HIV like deployment gp41/gp120?
> on the grounds that vaccines are something you only need to take once so the toxicity issue could be dodged

But we didn't take these vaccines once. We took many of them. Am I to understand a known side effect is liver toxicity for multiple doses?

I guess the issue is not about taking the medicine once vs twice, but rather « a few times » vs « daily »
It sure would be nice to see the data on length of time between doses to prevent toxicity. The fact they deleted all of that data sure is suspicious and incredibly worrying.
You have successfully read between the lines, yes.
They have not.
Toxicity depends on dose. COVID vaccines just need micrograms of material to induce an immune response, I imagine it takes more than that to edit the genes of a large organ.
There have sadly been cases where the vaccines did perform unintended gene editing. It shows up as people whose bodies are still producing spike protein months or years after vaccination.
Unfortunately, I do not know. Sorry here.

If anyone else does know, please chime in!

That also sounds like a recipe for a terrifying virus
It would allow a synthetic virus to get a foothold in your cells more easily, but our cells don't make Pseudouridine naturally which throws a big wrench in the ability of a virus to copy itself. And without replication you don't have a serious infection.
I would be surprised if viruses using U instead of T didn't already exist. After all, don't all viruses work by doing gene editing in vivo, except just localized to one cell?

EDIT: well, I suppose the question is whether cells of living beings could produce the U required for the viruses. But if not, then a wild virus using U instead of T to bypass our immunity also would not be a threat for that very reason.

It’s not the use of Uracil/Urimidine that bypasses the immune system. RNA uses Uracil instead of thymine in all organisms afaik, and RNA viruses certainly exist. It’s pseudouridine that’s the magic stuff.
I feel a bit proud that humanity healed a baby with this tech before any viruses were constructed/released.
I don't thnk the body has a way of making mRNA with pseudouridine.
It's almost exactly the premise of the movie "I am Legend," But it uses CRISPR instead of a Virus as the delivery mechanism.
It sounds like Spiderman tech.
Wow that could be also abused by some future covid-lab to bypass immunesystem and modify the DNA so the body disfunctions
Yeah, I mention this in some other comments that got greyed out.

Basically, the real deal technology here is the lipid bubbles that deliver the payloads to the right cells, not the base modification. You can go look at them, and a lot of other comments in this thread for more info on that tech.

TLDR: No way that anyone can bypass anything. These lipid bubbles are a miracle that they work at all; they're so unstable, it boggles the mind we can even use them to begin with. Doing any large scale DNA editing on an unsuspecting population would be so insanely expensive and difficult, I certain moving to the Moon would be cheaper.

Is this a troll? Pseudouridine mRNA isn't gene editing.
What do you mean? Is mRNA not used to produce the enzyme that these comments mentioned? I don't think they were saying mRNA is gene editing itself. Just commenting on a modified mRNA helping the process compared to normal mRNA. Might be misunderstanding though so correct me if I am
I dunno, I think they are being sloppy and conflating things. We can induce manufacture of proteins and can design proteins that carry out gene editing, so we can stack that knowledge together to induce cells to manufacture proteins that carry out gene edits, but it's the payload that is the gene editing, not the instruction to make the protein.

Given the merry movement to call the COVID vaccines gene editing, it rankles.

Hey, yeah, I'm not the most up to date on the current methods. Most of my knowhow is a bit out of date here. So thanks for piping up to correct things.

Do you know of any good resources that I can use to get up to speed on the exact methods they used for the baby?

My understanding, outdated as it is, is that we're using the mRNA to go in and create CRISPR-CAS9 slicers/dicers and additionally to that, the correct genes (not mRNA) to get stitched in. I would love to know more about how I am wrong here, as I am sure I'm not even close to really understanding it.

Thanks!

I think you're replying to someone edgelord about covid who got confused about some mrna statement and then back pedalled re-affirming what the article was about.
> [...] then the body's immune system doesn't nearly alarm as much, as it doesn't really see that mRNA as quite so dangerous

Please tell me there are measures to prevent this going into the wild. Please tell me this won't be used in large-scale industrial farming.

Yeah, it's not a drama.

The reason that the body doesn't alarm as much to Pseudouridine, is that it's not a 'natural' RNA base. Meaning that, for the most part, nature really never uses it and so we haven't evolved to look out for it. Nature uses Uridine and so immune systems have evolved to look out for random bits of RNA in the body that use it and then clean that all up.

It's like if you're looking to clean up legos in you house with a romba that only cleans up legos. And all of a sudden it finds a duplo. It's going to take a hot second to figure out what to do with the duplo. And in that time, you can sneak by and build a duplo fort. (Look, I know this analogy is bad, but it's the best I can come up with on the fly, sorry. If anyone else wnats to come up with a better one, please do!).

The Pseudouridine is used up and degraded very quickly inside the cell, minutes at the very very longest, more like microseconds. It's just part of a messenger (the 'm' in 'mRNA') to tell the cell to do things.

You might see mRNA gene editing in factory farms, but it would just be easier to do germline editing instead and skip spraying animals, plants, and fungi. Why waste the equipment, right?

I thought the analogy was good. They’re meant to be simple and easy to understand, not perfect representations.
As I understand it, there is nothing in nature that can create it, so the mRNA can never be accidentally replicated. It’s a safety mechanism that prevents escape.
Why would it be used in farming, you can edit the DNA before fertilization in farming, no need to do anything in vivo.
Industrial farming of what?
Farming? This will be used in warfare.
That would be less effective than bio and chemical weapons are. Which are not used because they just suck
I’m not sure of by “they just suck” you meant to imply that they’re ineffective. If that’s the case, I strongly disagree. They are not used because somehow all countries pretty much agreed they’re way TOO effective and horrific. Nobody wants it used on them, so nobody uses it on anyone else.

I cannot imagine a more effective weapon than an invisible gas that melts you alive, and there are MANY chemical and bio examples of these types of weapons.

>> They are not used because somehow all countries pretty much agreed they’re way TOO effective and horrific

That’s the story but it doesn’t hold up. Chemical weapons were used as recently as the Syrian civil war. I also think if they were really effective in modern warfare, Russia would have long ago deployed them in Ukraine.

More here: https://acoup.blog/2020/03/20/collections-why-dont-we-use-ch...

The ceiling for the destruction caused by biological weapons is far greater than chemical weapons. There is no chemical weapon that can hijack the victim to make more of it.
Not under the current way we do things, I don't imagine.

So the real trick here isn't the mRNA, it's the nanobubbles. Basically, you're putting these bits of mRNA into these little fat bubbles and then injecting those into the blood. Making those bubble shelf stable is really hard, hence the issues with temperature and the covid vaccine. To then make those little fat bubbles stable-ish in the blood is also a really hard thing to do. They have to get to the right places (in this baby's case, the liver) and then degrade there, drop off the mRNA, and not mess up other tissues all that much. Like, it's not terrible to make these micelles degrade in vivo, but to have them do that and not degrade in the tubes, ... wow... that is really difficult. There's a reason that Moderna is so highly valued, and it's these bubbles.

To try to then put these in a weapon that could do this though the airways would be, like, nearly impossible. Like, as in I think the second law of thermodynamics, let alone biology, and then simple industrial countermeasure like a N95 respirator, yeah, I think all of that makes it pretty much impossible to weaponize.

(Hedging my bets here: I don't know if they had to do all that with this baby, as you can kinda go from lab to baby really fast, since it's such a special case. But for mRNA based vaccines and cancer treatments, you have to deal with the shelf stable issue)

(Also, other bio people, yes, I am trying to explain to laymen here. Please chime in and tell me how I'm wrong here)

I think it doesn't need to be a direct weapon to be used in warfare. You can genetically modify your own military.
Yeah good point!

Something that a lot of people are unaware of is that US Military is allowed to do this. I forget the exact EO, but it was signed by Clinton and is in the 12333 chain of EOs. Mostly, this is used for the Anthrax vaccine. But, it does give clearance to do other forms of medical experimentation on warfighters.

No, really, I am serious here. This is true. I may have the details a bit off, so sorry there, but they can and do preform medical experiments on people without their consent. Now, to be fair, France does this too. They do sham surgeries over there. Non-consenting human medical experimentation is quite the rabbit-hole.

So, I can kinda see in the next 10 years, certainly the next 50, a routine shot given to warfighters to help them with things like blood loss, or vitamin C production, or fast twitch muscles, or whatever. The legal framework is already there and has been for a while, it's just an efficacy issue, honestly.

I suppose a downside (depending on your perspective) of this is that it will make people who are genetically modified in this fashion trivial to detect.

That's good if your goals are to detect genetic modification which may be considered cheating in competitive sports.

That's bad if your goals are to detect genetically modified people and discriminate against them.

I see a near future where the kind of people who loathe things like vaccines and genuinely believe that vaccines can spread illness to the non-vaccinated feel the same way about other things like genetic modification and use legal mechanisms to discriminate and persecute people who are genetically modified.

> it will make people who are genetically modified in this fashion trivial to detect.

I'm not totally sure. If I understand it correctly, the mRNA contains pseudouridine, and it makes the protein that will edit the DNA. The edited DNA should look like a normal one.

Ah. That makes sense. My mistake.
I'm less interested in detecting genetic modification for the purposes of discrimination than making sure it's available to everyone.

Assuming requisite safety of course.

I'm more concerned about the possible negative unintended consequences of making it available to everyone first. Genetic modification is well-explored Pandora's Box in science fiction and present humanity seems so ill-equipped in collective philosophy and reason to handle a paradigm shift of that magnitude.
RNA is a byproduct, not a "source of truth" in technical terms. The DNA is. DNA is converted to RNA and then executed and then discarded, per my understanding. The DNA is still AGCT.
Don't be silly, the rich will want their babies to be perfect so gene editing will be legal and considered OK.
Can you explain why this is a bad thing, or is it just “”the rich” bad”?
Not OP, but presumably it's because it could cement a permanent divide between classes. We still have quite a bit of upward mobility in the US, but health is a tremendous predictor of future outcomes, so gating that to the rich is dangerous to the stability of society in that way.
This seems like more of an issue with accessibility of the treatment than the treatment itself

If we could make most children smart, productive, ambitious, courteous, civil, conscientious, honorable, strong... the value to society is probably high enough to justify covering it for almost anyone.

This is already true to a great extent. A family with lots of genetic health conditions are probably going to remain poor.
I'm explaining that gene modification will not be considered illegal or bad because the rich will have a vested interest in it being legal. This is a reply to GP saying:

> use legal mechanisms to discriminate and persecute people who are genetically modified

I believe there is no way this will happen, because legal mechanisms are driven by the whims of the rich, and they will want gene editing to be legal. So there will beno legal mechanisms to discriminate against those who have been edited.

If you're going to make the comparison with vaccines, and if history is any indication, the more realistic worry would be the other way around (since that's where the money is): that genetic modifications will be mandated, and that those who object will be discriminated against.

[And no, I am not anti-vax, nor anti-gene-editing.]

“What do you mean you haven’t modified your chromosome 7 CFTR gene? And you’re planning to have children???
I don't know anything about gene editing, but my grandmother was a carrier of the BRCA mutation. It would have saved a lot of heartbreak in my family if that could have been detected and repaired. My aunt, mom, and brother (age 4) all died of cancer. I'm just glad that my mom didn't know she had the mutation and passed it on to her child.
It wouldn’t be crazy if I teleported 50 years in the future and heard someone tell me that not doing this is akin to child abuse. Obviously all suffering is relative, etc. etc., but it’s just interesting to imagine a world where the societal pressure to make a perfect child is high.
Careful with qualifiers there. I genuinely believe that vaccines can spread illness to the non-vaccinated, since it has happened many times and is well-documented. For example, it's why only the inactivated (aka "dead" virus) polio vaccine has been used in the US since 2000.

I'm not arguing about whether the risks of the attenuated virus outweigh the benefits. I think the data are very clear there. (Heh -- and I'm sure the vast majority of people will agree with that statement, even if they disagree on what the clear answer is....)

It's just that one shouldn't mock a belief without including the necessary qualifiers, as otherwise you're setting up an argument that can be invalidated by being shown to be factually incorrect.

As for genetic modification of humans, IMO there are a lot of very good reasons to be wary, most of them social. Fatal hereditary conditions are obviously an easy call. What about autism (not saying there's a genetic link there to use, just a what if)? Or other neurodivergence? Like being a troublemaker in class? Or voting for the party that doesn't control the medical incentive structure? Heck, let's stick with the fatal hereditary conditions, and say the editing does not affect germ cells. Is it ok if the human race gradually becomes dependent on gene editing to produce viable offspring? Or let's say it does extend to germ cells. The population with resources becomes genetically superior (eg in the sense of natural lifespan and lower medical costs) to those without, creating a solid scientific rationale for eugenics. Think of it as redlining carved into our blood.

I don't think discrimination against the genetically modified is the only potential problem here.

As humans, we'll deal with these problems the way we've dealt with everything else transformational. Namely: very, very badly.

At one time organ transplants were considered an ethical grey area (perhaps they still are by some), but I think most people now would consider it better to save lives in such a manner when it only brings help to those who need it and it's possible to, compared to the alternative. Having the capability may mean that things like organ theft now exist, but the benefits around the world outweigh the nastiness that has always come as part of human nature.
I agree that organ transplants are a net positive, and in fact are far less susceptible to unintended consequences (there's a pretty low limit to the number of organs and operations involved, for one.)

I also think that gene repair is a net positive. I would just like us to, for once, look ahead and foresee some of the foreseeable consequences and act to mitigate them before the bulk of the damage is done.

I don't think it's necessary to slow the development; gene therapy is too desperately needed, and slowing it down so that we can prepare is not going to cause us to prepare.

I mean, I feel like autism is a terrible example here, it's not just some quirky personality trait, it's a reality people live with that runs the gamut from difficult to completely debilitating. Even the more mild forms of autism cause extreme difficulty in many aspects of life. If that was curable or preventable, that'd be great.

If it turns out some pathogen or chemical made me autistic, regardless of whether or not I could be cured as an adult, I'd have certainly preferred to live the reality where I had been as a child.

I think a better reason autism is a bad example is that part of its definition is that it is a consequence of fundamental brain structure and development (differentiating it from other psychological disorders which are acquired and more malleable). These aren't things you will "undo" with some gene edits. The whole brain has developed in a different way. Short of re-growing them a new brain you aren't going to change that (assuming you wanted to).
I think scientists have believed for a while that any type of “autism cure” would need to be extremely early intervention for maximum effectiveness for exactly this reason. I remember speaking with a team that was studying detection of autism in the womb for this exact reason.
Sure, the purpose was to illustrate a slippery slope, and curing autism is meant to be more obviously good than abolishing all forms of neurodivergence but less obviously good than fixing fatal hereditary diseases.

I'm not going to claim that I know the perfect place to draw the line.

> vaccines can spread illness to the non-vaccinated, since it has happened many times and is well-documented

Nothing in medicine is certain. Nearly any medical treatment has a small chance it could kill you. There’s a small, but non-zero chance of a lethal infection even if they injected you with saline, odds that rise dramatically in less than sanitary conditions.

Ironically the use of the attenuated oral vaccine for polio was because of the risk of infection in places where the availability of sterile syringes was hard to guarantee. It’s all about the relative odds.

>...and say the editing does not affect germ cells.

To me the wildest scenarios take this off the table.

Gene therapies are pretty incredible. Some of them are still making a button-hole with a machete, but that's relative to the previous medical intervention of a button-hole with a tank's main gun.

One of the treatments for sickle-cell involves switching off the gene that makes the malfunctioning red blood cells, but of course that's not sufficient; you'd stop making red blood cells completely and you'd die. So it's combined with a modification that switches on a gene that all humans express pre-birth that causes your body to make "super-blood": red blood cells with significantly more binding points for oxygen. This is necessary because a fetus gets oxygen from its mother's blood, so the increased binding affinity is useful for pulling the oxygen towards the fetus at the placental interface. After birth, expression of that gene is disabled and regular RBC genes switch on.

So the therapy doesn't "fix" sickle RBCs; it disables the body's ability to make them and re-enables fetal RBCs! I have seen no literature on whether having fetal RBCs in adulthood has any benefits or drawbacks (besides changing the affinity ratio for their fetus if the patient gets pregnant, I imagine increased-affinity RBC could help for athletics... But I also imagine it requires more iron to generate them so has dietary impact).

High affinity RBCs would actually be a disadvantage for athletics. You actually don't need very high affinity to pick up oxygen from the lungs -- your lungs are comparatively extremely high in oxygen. What matters more is being able to drop the oxygen off in peripheral tissues. Higher affinity means that it's harder to actually deliver the oxygen, which is why we evolutionarily developed the switch away from fetal hemoglobin.
I thought the evolutionary impetus for fetal hemoglobin was because it greatly increases the efficiency of fetal oxygen uptake across the placental interface?

From shadowgovt:

> I have seen no literature on whether having fetal RBCs in adulthood has any benefits or drawbacks (besides changing the affinity ratio for their fetus if the patient gets pregnant

This was exactly the question that popped into my mind when I read about switching from normal adult RBCs to fetal RBCs: does this therapy reduce the likelihood of carrying a baby to term?

Yes, that is true. I phrased that badly -- it's more that we didn't take the evolutionary branch where we retain the fetal hemoglobin because it is maladaptive in adults.
I have natural persistence of fetal hemoglobin which counteracts my inherited thalassemia trait.

No problems really..never knew I had it until I was told I had thalassemia trait as part of genetic testing. My hemoglobin panel shows fetal hemoglobin.

Appreciate the explanations and the analogies.
A chemist friend of mine did his thesis on lipid vesicles, and I remember my mind being blown when he told me these are modelled as a liquid on the 2D plane of the membrane, but as a solid on the 1D orthogonal direction because the energy to swap two lipid molecules side by side is incredibly low (because it makes barely any difference), while the energy to swap them orthogonally to the membrane is much larger (because they would point in the wrong direction).
Oh that's neat
> That is one of the most incredible things I have ever read.

This is even more great reading behind the above:

https://en.wikipedia.org/wiki/Jennifer_Doudna

A rare case where the list of awards she's received is so long it needs a separate Wikipedia page https://en.wikipedia.org/wiki/List_of_awards_and_honors_rece...
Walter Isaacson's book "The Code Breaker" is about this subject. I couldn't put it down.
All his books are like that. The Innovators is my personal favorite.
A darker passage in the history of gene editing, but still an interesting story and something not to forget:

https://www.sciencehistory.org/stories/magazine/the-death-of...

They shared the Nobel prize for CRISPR. Yet you chose to lead with the American one. :/
That's because the link I shared immediately cites Doudna and Charpentier as a team.

After edits were disabled, I thought perhaps there's a page for Charpentier too, which there was, but later than i could edit.

They're both amazing scientists.

She's got a couple of great appearances on RadioLab.
Bear in mind that they intentionally choose something that was soluble - ie the easiest thing possible. So it's doesn't mean everything is now solvable.

For example it's no coincidence this is a liver disease as basically almost everything you inject in the bloodstream ends up concentrating in the liver by default - if you needed to target another organ with your LNP it would be much harder. Most of the time people are trying to stop stuff accumulating in the liver!

The liver has other special properties that are helpful as well.

Having said all that - it is still a massive achievement.

> That is one of the most incredible things I have ever read.

Biology is incredible - and you can do incredible things if you leverage it.

> that was soluble

solvable

soluble has two meanings.

- able to dissolve in solvent

- able to be solved.

Is the second meaning archaic?
How old does it need to be to be archaic?

Here is a use in the title of a quite famous popular science book from the 1960's.

https://www.routledge.com/The-Art-of-the-Soluble/Medawar/p/b...

Huh, TIL!
I literally said the same thing out loud.

I had heard about CRISPR a while back but most reporting on it kind of hand waved over the mechanisms of how it actually accomplishes its work. What these researchers have figured out to make this work absolutely blows my mind.

AFAICT, CRISPR still make many bad edits. We relies on the fact that most of those bad edit won't survive.
It can make “bad edits” eg off target effects. But in this case there were, as far as is known, none. It’s aided that this was a single nucleotide defect.

They specifically tested for off target edits in the mouse study and found no harmful edits (and very rare off target ones). That plus the specific targeting of the liver cells (no germ line effect expected), makes this a low risk approach and certainly better than doing nothing.

Thanks to DOGE you might read less and less about this kind of things.
Unfortunately, this is true. From the article:

> The implications of the treatment go far beyond treating KJ, said Dr. Peter Marks, who was the Food and Drug Administration official overseeing gene-therapy regulation until he recently resigned over disagreements with Robert F. Kennedy Jr., the secretary of health and human services.

Once the gene has been edited, things will work. But at some point that cell will die. Why would the replacement cell also have the edit? The DNA in the rest of the body's cells will still not be correct.
When cells duplicate they have the same (altered) DNA so the mutated cells survive.

You'll end up with mosaicism (cells with different DNA) but presumably you have enough of the new cells to fix the problem the original ones had.

You don't need to fix all the body, you just need to fix some of the, say, liver, and you're good.

> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene.

This isnt entirely unlike the method mRNA vaccines use. Through some clever biochemistry, mRNA vaccines get bits of code into cells where the cell's built in code compilers manufacture proteins that induce immunity.

We have developed software patches for our biology.

Made it sound like it's a computer, is it Turing complete?
It's fundamentally different than a computer and arguably more complete.

The talk of "crawling along the genome" is kinda fundamentally wrong though and is a bit irking - CRISPR kinda just bumps around until it hits a PAM site, in which case it starts checking against sgRNA. Much more random than they make it seem

This is crazier: https://www.sciencealert.com/are-we-all-quantum-computers-wi...

About CRISP, it's like the ultimate Perl+Regex for the body.

sounds more like sed
Perl and awk can do everything sed(1) does, but it an easier way.
I know
"Bumps around until it hits" sounds like a set of magnets arranged to only mate up in a specific direction. Except we have four nucleotides rather than only two magnetic poles.
If this thread interests you, you should check out "Blood Music" by Greg Bear. It's pretty old but the premise is that a researcher 'closes the loop' in a bunch of cells by making them able to edit their own DNA - thus making them Turing Complete.

Hilarity subsequently ensues.

Cells are already able to edit their own DNA. Examples include the yeast mating switch, in which the "active" gene is replaced by one of two templates, determining the role the yeast plays in mating (https://en.wikipedia.org/wiki/Mating_of_yeast#Mechanics_of_t...)

Further, your immune system does some clever combinatorial swapping to achieve diversity (https://en.wikipedia.org/wiki/V(D)J_recombination). The generated diversity is then screened by the immune system to find highly effective antibodies that bind to specific foreign invaders.

Doing something actually interesting from an engineering perspective makes for fun science fiction, but as always, the specific details in that story would be a very unlikely outcome.

As I get older, I'd be happy with some minor incremental progress on addressing myopia and hyperopia.
Wouldn't it be surprising if it weren't? There's a bunch of things that are Turing complete, but they are not literally a molecular tape with machinery to read and write it.
Made me think of

    It was only in college, when I read Douglas Hofstadter’s Gödel, Escher, Bach, that I came to understand cells as recursively self-modifying programs. The language alone was evocative. It suggested that the embryo—DNA making RNA, RNA making protein, protein regulating the transcription of DNA into RNA—was like a small Lisp program, with macros begetting macros begetting macros, the source code containing within it all of the instructions required for life on Earth. Could anything more interesting be imagined?

    Someone should have said this to me:

    > Imagine a flashy spaceship lands in your backyard. The door opens and you are invited to investigate everything to see what you can learn. The technology is clearly millions of years beyond what we can make.
    >
    > This is biology.
   
    –Bert Hubert, “Our Amazing Immune System”
from https://jsomers.net/i-should-have-loved-biology/
>> Imagine a flashy spaceship

I misread this as "fleshy" for a moment, and the quote almost works better that way.

Me too. It did. Huh.
This system isn't really turing complete, but existing biology provides everything required to make a computer which is Turing complete (assuming non-infinite tape size).

True programmatic biology is still very underdeveloped. I have seen logic gates, memory, and state machines all implemented, but I don't think anybody has built somethign with a straightforward instruction set, program counter, addressable RAM, and registers that was useful enough to justify advanced research.

Yeah, in some ways, the genetic code and molecular biology around transcription, etc, more closely resembles the abstract Turing Machine than an actual computer does. Absolutely fascinating that the messy world of biology ends up being pretty analogous to the clean world of binary logic. Gene sizes are expressed in kilobases, where a base carries 2 bits of information.
I think I recall reading at least some papers or at least exercises trying to draw analogies between Turing machines and ribosome/proteonsome and other type of cellular proteins, but I can't remember back to that class some 20 years ago...
Sounds kind of like the infinite tape machine....
About 6 billion letters in human DNA.
Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
TIL my years of perl regex'ing was preparing me for a future of DNA gene warfare

(core war, anybody?)

I don't know if it still is, but, for a while, Perl was actually fairly popular in bioinformatics: https://bioperl.org/
So, Perl or sed. If it's Perl, the guy from XKCD was right. And, maybe, Larry Wall.
Cue the book "The Code Breaker" [0]. I read it a long time ago and such an incredible book and journey by Jennifer Doudna and Emmanuel Charpentier. Do check it out

https://en.wikipedia.org/wiki/The_Code_Breaker

How does it know how to gps around? From what I know everything down there is a chemical reaction with some minimal physical motion, but how do you program it to know where to change and what and how.
It doesn’t know anything about where it “needs” to go. One of the weirder and more unintuitive things about molecular biology is just how fast everything moves inside a cell. The CRISPR molecule diffuses from one side of the nucleus to the other in a couple seconds and probably bumps into the entirety of the genome in a matter of minutes or hours. It’s very, very crowded inside cells, proteins and DNA and metabolites are constantly bumping into each other and are tumbling around at frankly incomprehensible rates. So, nothing needs to “know” where it needs to go, it simply gets pushed and jostled around until arrives there and then the attraction between the CRISPR’s RNA and the DNA takes over
This sounds so much like "simulated annealing" with reactive components and almost no lack of energy in the system. Various energies/reactions occur, which unlock or lock out other possible reactions.
Add gene has a great guide as to what goes on at the molecular level: https://www.addgene.org/guides/crispr/

Essentially you can design an rna molecular that contains a 20 nucleotide long sequence that can target your region of interest, with the caveat that there is a standard recognition sequence proximal to your sequence of interest (PAM sequence)

It’s more like a “ctrl+F” for DNA. Hopefully there’s only 1 match (the target site).
So you create a molecule that binds to a certain location in the dna, and then deploy a billion of them?
You need billions to cover multiple cells, you don't need many for a cell.

The counterintuitive part is how fast thermal motion is relative to the size of dna.

In body temperature water, the thermal velocity of water molecules jostling around everything is ~600m/s. The nucleus of a human cell is ~6µm in diameter. That is, your average water molecule bounces around at a speed that makes it move from one end of the nucleus to another roughly 100 million times per second.

Larger molecules move more slowly, but they still zip around fast enough that nothing needs to "seek" to a specific position in a cell to get there, everything will touch everything just from thermal random walk in a very short time. So how biology works is that inside the cell there might be just one messenger, which will have to hit a specific piece of dna just right in order to do anything, but that's still nearly instantaneous from our perspective.

More or less, yes.

An interesting part of the study was determining what a clinical dose _should_ be. You need enough to edit enough liver cells. But don’t really want to completely overdo it to limit potentially negative side effects. Seems like they got it right enough here, with the first dose having some effect and the subsequent dose having more.

Well its more like search and replace, where you cross your fingers that it only replaces the words you are trying replace without impacting the rest of the text in the document.
You should have seen the homebrew guy’s talk on DIY CRISPR where he injected himself on stage. And that was years ago. Incredible times for incredible work.
I work on lipids and i myself didn't know they could be so much practically important.
I know someone well who works in this space, personalized gene therapy as cancer treatment.

> until it finds the exact DNA letter that needs to be changed.

This pine is disingenuous (at best). There is no way of guaranteeing where the DNA is inserted. It is designed to only slot into a very specific portion of the DNA but they don't have a way to control that precisely, the accuracy is high but "exact DNA letter" is skipping over a few pretty important details.

To be clear I'm not saying it is ineffective or unsafe, only that the claim made is marketing speak and not actually true.

The approach they used which is base editing doesn’t actually insert or remove DNA, it actually uses an enzyme to convert one base to another, which is much safer as this doesn’t require a double strand break in DNA: https://blog.addgene.org/single-base-editing-with-crispr
That is interesting, I didn't catch the difference my first time through the article.

I do still question their claim of 100% precise results though. At least based on that high level description I can definitely see it being safer, but I question any scientific claim that is an absolute.

Specific to the editing vs insertion mechanism, I question how it doesn't run into similar constraints where the mechanics of targeting exact portions of the DNA can occasionally miss or impact the wrong segment of DNA entirely.

I haven't dug as deeply down the base pair conversion though, so I could absolutely be wrong!

Running this article through GPT and asking it more questions is one of the most incredible allocations of productivity I have ever seen
Yep, this is truly incredible!
Never bet against science !
Also presents a terrifying prospect of malicious use.