Hacker News new | ask | show | jobs
by daemonk 3800 days ago
What do you mean by the primers can just well be amplifying the template? How does that explain knock-ins without an actual insertion? And there are plenty of knock-in CRISPR papers out there. Just literally search for "CRISPR knock-in".
2 comments

Let me ask this. Say you have sequence A that is not supposed to exist before your treatment and sequence B that you have added to the environment in large amounts. Is it safe to use primers where one matches exactly to sequence B and the other is this similar?

CTCATTAGGCACCCCAGGCTTTACA

CTCAGT------CCCAGGCTTTACA

Are you suggesting that they are just detecting the un-incorporated foreign DNA after CRISPR? I think the fact it has been shown that the knocked-in DNA is inherited to the progeny is strong enough evidence that the DNA was actually inserted.

Unless you want to argue that the un-incorporated DNA was also transmitted to the next generation, which honestly, is extremely unlikely.

That could possibly explain some results, but not those involving transmission. If the knocked-in DNA is transmitted to the next generation then I'd think it must have gotten incorporated somewhere, however, this need not be at the intended site if the primers are amplifying the template.

Then again, supposedly shingles is caused by extragenomic Varicella-zoster DNA that is somehow stable for decades and can be passed on during pregnancy. I'm not sure I believe that though, and of course that is viral DNA.

Anyway, in that Ruan et al (2015) they claim to have detected exactly the expected sequence across the junction in at least a few cells. I can't think of any explanation for that data other than CRISPR working as advertised. However, they don't report in what percent of the cells this was observed.

Edit: I mean supposedly those exact sequences shown in figure S2 never physically existed before and now they do, exactly as predicted by the theory. That is strong evidence.

Ok, I did that search and here is the first paper I found: http://www.nature.com/articles/srep14253

EDIT: Let me look again at this paper later.